[Porcellio scaber] Cloporte scabreux

Ici est le point de rendez-vous des Cloportes.

Animateurs : noelouigre1, entonantes44

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Porcellio scaber] Cloporte scabreux

Message par noelouigre1 » vendredi 15 juin 2018, 8:36

Si tu as des pistes je suis preneur :mrgreen:

Balises :

LHommeInvisible
Membre confirmé
Enregistré le : jeudi 22 octobre 2015, 12:12
Localisation : Région Parisienne
Contact :

[Porcellio scaber] Cloporte scabreux

Message par LHommeInvisible » vendredi 15 juin 2018, 9:53

réponse en MP :wink:

après pour ce qui est d'avoir des séquences de cloclo, je te rassure, t'en as déjà qqs unes en stock (bon pour le CO1 c'est surtout de la ligie)
LHI,

ACTTGGATTTGTTGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTTGACACT

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Porcellio scaber] Cloporte scabreux

Message par noelouigre1 » vendredi 15 juin 2018, 11:24

Oui surement... mais comme on a beaucoup d'endémiques et subendémiques, à mon avis à part les quelques Oritoniscus séquencés par Dalens, Rousset et Fournier on doit pas aller bien loin. Et les espèces séquencées sont aussi certainement les espèces les plus répandues, pour lesquelles le recours à l'analyse génet en complément des critères morpho ne représente aucun intérêt ?
Quand on s'attaquera aux "groupe" des Porcellio orarum par exemple je pense qu'on aura des descriptions d'espèces à faire^^

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Porcellio scaber] Cloporte scabreux

Message par DrPorcellion » lundi 9 juillet 2018, 15:06

Sur le principe, je serais partant (c'est pas ce que ça coûte le Sanger ajd...) mais c'est surtout que ça prendrait un temps assez monstrueux en extractions, en PCR, etc. C'est dur de faire un projet d'une telle ampleur juste sur le temps "bonus"...

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Porcellio scaber] Cloporte scabreux

Message par noelouigre1 » mercredi 18 juillet 2018, 8:56

Allez, montes-nous un petit programme de financements !
Tu peux avoir le soutien du muséum si tu remontes 3 posts au-dessus :mrgreen:

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Porcellio scaber] Cloporte scabreux

Message par entonantes44 » mercredi 22 août 2018, 18:13

Je pense que Benjamin n'attend que ça un financement pour un projet comme celui-ci...
Si cela fonctionne il y aura des soutiens :D
Brendan

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Porcellio scaber] Cloporte scabreux

Message par noelouigre1 » mercredi 19 septembre 2018, 13:24

Un article récent sur l'intérêt de la chose... à voir aussi pour les marqueurs utilisés (perso je n'y connais rien :mrgreen: )

https://www.researchgate.net/publicatio ... e_taxonomy

Répondre Sujet précédentSujet suivant

Retourner vers « Isopodes »