[Porcellio sp.] Gros cloporte espagnol

Ici est le point de rendez-vous des Cloportes.

Animateurs : entonantes44, noelouigre1

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Porcellio sp.] Gros cloporte espagnol

Message par DrPorcellion » vendredi 22 juillet 2016, 10:57

Salut !
De retour de vacances dans les montagnes, je vous propose quelques cloporto-trouvailles. Pour commencer, un gros cloporte blanc (d'où la photo prise en deux fois) qui me rappelle furieusement celui vu récemment : viewtopic.php?f=45&t=155282. Trouvée sous une pierre, c'est une femelle. Je n'ai pas encore essayé de pousser l'identification plus loin que Porcellio mais ça viendra.

Image
Benjamin Herran : Espagne : Alquézar : 22112 : 21/07/2016
Altitude : NR - Taille : 20 mm
Réf. : 167559
Modifié en dernier par DrPorcellion le vendredi 22 juillet 2016, 20:48, modifié 1 fois.

Balises :

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

Gros cloporte espagnol

Message par entonantes44 » vendredi 22 juillet 2016, 15:47

Belle bête! Dommage que ce soit une femelle mais on verra. Tu as réussi à te procurer la Thèse de Cruz finalement?

Il a de petites moustaches?
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

Gros cloporte espagnol

Message par DrPorcellion » vendredi 22 juillet 2016, 20:52

Je ne connais pas cette thèse (elle a été mentionnée par Alain Bertrand à ce que je vois). C'est quoi son titre ?

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

Gros cloporte espagnol

Message par entonantes44 » vendredi 22 juillet 2016, 22:09

Je croyais t'avoir envoyé ce titre par MP? Je vais regarder.
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

Gros cloporte espagnol

Message par DrPorcellion » samedi 23 juillet 2016, 19:36

Ah oui ! Au temps pour moi, j'avais oublié.
Je rappelle donc le titre : CRUZ A. 1990. Contribución al conocimiento de los Isópodos terrestres (Oniscidea) de la Península Ibérica y Baleares. Memoria redactada para optar al grado de Doctor en Ciencias Biológicas por el Licenciado. Departament de biologia animal (Zoologia), Facultat de Biologia, Universitat de Barcelona.
Je la chercherai prochainement !

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

Gros cloporte espagnol

Message par noelouigre1 » dimanche 24 juillet 2016, 6:43

Je pense que si tu la trouves il y aura plusieurs volontaires pour en avoir une copie :)
La diffusion a été extrêmement limitée et à part S. Taiti, Lluc Garcia et H. Dalens, je ne connais personne d'autre à la posséder. L'auteure a refusé sa duplication...

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Porcellio sp.] Gros cloporte espagnol

Message par DrPorcellion » jeudi 8 septembre 2016, 9:57

Voilà la séquence de la COI (il a suffi d'un prélèvement d'une patte) :
>Psp_blanc_LCO-HCO
ATATTAATCACAGTTGAAATAAAGTTTACAGCCCCTAGAATGGAGGAAACCCCTGCTAAATGTAAAGAAAAAATTCCTAAATCTACTGAAGCCCCTCTATGCGCAATACCTCCAGCTAGAGGAGGGTATACTGTCCACCCAGTTCCTATCCCTCTTTCTACTAACCCTCTACTAAAAAGAAGAGTTAAAGATGGTGGTAGAAGTCAAAATCTTATATTATTTATCCGTGGAAAAGCTATATCGGGAGCTCCTAACATTAAAGGCACCAGCCAATTTCCAAACCCCCCAATTATAATTGGTATTACTATAAAAAAAATTATTACAAAAGCGTGGGCTGTTACAATAACATTATAAATCTGGTCGTCCCCAATTAAGCTACCAGGCTGCCCTAATTCAGTACGAATTAAAATTCTCAAACCTGTG
Un petit blast nous indique :
Porcellio spinicornis voucher BIOUG<CAN>:MaPor000 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial // Max-score:449 // Total-score:449 // Query-cover:100% // E-value:2e-122 // Ident:86% // n°:DQ889123.1

Analyse à pousser à l'occasion car la banque NCBI n'est pas du tout complète.

Edit:
Nouvelle séquence de la COI plus complète :
GGGTCACCCCCTCCCCTGGGGTCAAAAAAAGAAGTATTTAAATTACGGTCTGTTAACAATATTGTGATAGCTCCAGCCAAAACAGGCAAAGATAATAACAAAAGCACCGCTGTGATTAAGACAGACCAAACAAATAAAGGAATACGATCTATTTTTATTCCAGAGACTCGTATATTAATCACAGTTGAAATAAAGTTTACAGCCCCTAGAATGGAGGAAACCCCTGCTAAATGTAAAGAAAAAATTCCTAAATCTACTGAAGCCCCTCTATGCGCAATACCTCCAGCTAGAGGAGGGTATACTGTCCACCCAGTTCCTATCCCTCTTTCTACTAACCCTCTACTAAAAAGAAGAGTTAAAGATGGTGGTAGAAGTCAAAATCTTATATTATTTATCCGTGGAAAAGCTATATCGGGAGCTCCTAACATTAAAGGCACCAGCCAATTTCCAAACCCCCCAATTATAATTGGTATTACTATAAAAAAAATTATTACAAAAGCGTGGGCTGTTACAATAACATTATAAATCTGGTCGTCCCCAATTAAGCTACCAGGCTGCCCTAATTCAGTACGAATTAAAATTCTCAAACCTGTGCCCGCAGCTCCAGATCAAGCACCA
Le Blast sort encore le spinicornis ... car je crois que c'est le seul Porcellio de leur banque !!
Modifié en dernier par DrPorcellion le mercredi 7 décembre 2016, 16:03, modifié 1 fois.

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Porcellio sp.] Gros cloporte espagnol

Message par noelouigre1 » jeudi 8 septembre 2016, 10:55

Salut,
Je ne pense pas que ce soit cette espèce, le lobe frontal est triangulaire, les lobes latéraux trop développés, etc.
Je ne comprends pas tout aux analyses génet :oops: Si je comprends bien la séquence est identique à 86% aux refs dispos pour P. spinicornis, c'est cela ??

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Porcellio sp.] Gros cloporte espagnol

Message par entonantes44 » samedi 10 septembre 2016, 14:59

Super d'avoir la séquence, c'est grave la classe!

Tu vas pouvoir nous faire des sujets de dingue, avec le spécimen in natura, de beaux petits clichés sous bino, le Per7 et le séquençage...
noelouigre1 a écrit :Je ne pense pas que ce soit cette espèce, le lobe frontal est triangulaire, les lobes latéraux trop développés, etc.
Je ne comprends pas tout aux analyses génet Si je comprends bien la séquence est identique à 86% aux refs dispos pour P. spinicornis, c'est cela ??
C'est bien ça pour les 86%, mais je ne pense pas que Benjamin suggère que ce soit un P.spinicornis.
Une fois qu'il y eu séquençage, tu interroges la base de données qui cherche ce qu'il a de plus proche. L'efficacité du résultat va dépendre de la qualité du séquençage mais aussi de l'exhaustivité de la base (NCBI). C'est ce que Benjamn disait lorsqu'il disait que NCBI n'était pas du tout complète (pour les isopodes), je ne sais pas qu'elles sont les espèces présentes?

En gros, Benjamin a du, je suppose, extraire les ARN (instables) de son cloporte, les rétrotranscrire en ADN (stables). Ensuite grâce à des amorces spécifiques il va pouvoir amplifier et isoler spécifiquement un ADN qui correspond généralement à une séquence codant pour une protéine fixée au préalable. Puis cette séquence est envoyée au séquençage où grâce à une machine dédiée et un logiciel de reconstruction il obtient un résultat final : voici la séquence putative du morceau de gène recherché. Il existe ensuite des bases de données énormes (type NCBI) qui permettent de faire une recherche (BLAST) parmi toutes les séquences déposées en accès libre par les labos du monde entier (ou presque). On peut donc voir si cette séquence se rapproche d'une autre.

Après 86% cela veut un peut tout et rien dire dans l'absolu. 86% d'homologie cela dépend de ce qui est comparé. Car toutes les séquences ne varient pas au même rythme dans les génomes. Par exemple si je regarde Rad51 qui répare l'ADN des cellules (donc très importante) les séquences sont identiques chez presque tous les mammifères et il y 86% d'homologie pour (le gène de) cette protéine entre l'homme et un poisson, un oursin ou un crabe. Pa contre, si on regarde un gène moins essentiel comme celui qui permet de faire une gouttière linguale chez l'homme à mon avis il n'y a pas 86% d'homologie avec une souris.

En l’occurrence le gène c'est COI cytochrome oxydase unit (un morceau cf "partial cds"), il ne doit pas varier tant que ça si?

Benjamin me reprendra si j'ai dis une erreur où fais une approximation. J'espère que cela aide à comprendre un peu mieux. Éventuellement si tu as le temps se serait top de nous faire un petit sujet avec juste le nom des principales espèces pour lesquelles on possède déjà une séquence. Dans le labo vous faîtes tout le temps ce gène? Pour vos espèces de réf aussi je suppose?
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Porcellio sp.] Gros cloporte espagnol

Message par DrPorcellion » samedi 10 septembre 2016, 16:16

Merci beaucoup pour les explications : c'est un sans faute ! :0024:

Je n'ai pas poussé beaucoup l'analyse mais je suis surpris qu'il n'y ait pas plus de Porcellio qui sortent dans ce 1er blast. Sur les banques, pour ce genre et pour le marqueur COI, on trouve : scaber, laevis, dilatatus, baidensis, hyblaeus, imbutus, spinicornis et siculoccidentalis (pour les curieux il suffit de taper "Isopoda COI" dans http://www.ncbi.nlm.nih.gov/nuccore). Le problème est qu'avec un degré de similarité à peine plus faible, on trouve ensuite dans la recherche du Trachelipus et même de l'Idotea, ce qui est fort surprenant !

Tout ça pour dire que le marqueur (COI), a fortiori partiel, n'est pas toujours suffisant. A la limite la conclusion la plus vraisemblable est que mon Porcellio n'est aucun de ceux cités ci-dessus, et nous voilà bien avancés :-P

Il y a un autre marqueur souvent utilisé c'est le 16S (et aussi le 18S). Le mieux reste de combiner les marqueurs et une bonne façon de faire ça c'est les nouvelles méthodes de séquençage massif.

Répondre Sujet précédentSujet suivant

Retourner vers « Isopodes »