[Pagana dimorpha] Cloporte de l'hémisphère sud

Ici est le point de rendez-vous des Cloportes.

Animateurs : entonantes44, noelouigre1

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par DrPorcellion » lundi 31 octobre 2016, 17:39

Sur l'INPN je trouve : Pagana dimorpha (Dollfus, 1895), Trachelipodidae.
Pour le sexe j'ai un doute mais je pense que c'est bien un adulte.

Balises :

Avatar du membre
lauzette
Animatrice - Admin-galerie
Enregistré le : mercredi 7 octobre 2015, 20:12
Localisation : 31

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par lauzette » lundi 31 octobre 2016, 18:33

Merci :)
"Vous n'avez cessé d'essayer ? Vous n'avez cessé d'échouer ? Aucune importance. Réessayez, échouez encore, échouez mieux." Samuel Beckett

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

Cloporte de l'hémisphère sud

Message par entonantes44 » mardi 1 novembre 2016, 18:28

noelouigre1 a écrit : L'idéal serait de compléter par la dissection d'un mâle, ce qui nous en apprendra plus que les séquençages :0007:
Pour l'instant oui, mais si le séquençage continue à se généraliser, on pourra peut être revenir sur ce poste et réanalyser le résultat en comparant avec des banques plus à jour pour les isopodes. L'idéal serait d'avoir les deux (séquences+caractères). Mais on a rarement les séquences.

D'ailleurs Benjamin tu penses que tu pourrais l'inclure? Si cela ne pose pas de problème? Si la séquence est assez propre?
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par DrPorcellion » mercredi 2 novembre 2016, 11:42

Oui tu as raison. La séquence n'était vraiment pas exploitable dans l'état mais je vais essayer de la repasser dans les jours qui viennent pour améliorer ça et vous la communiquer si c'est mieux.

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par DrPorcellion » mercredi 7 décembre 2016, 16:18

Et voici la séquence (tout de suite ça marche bcp mieux avec les amorces à la bonne concentration...) :
>Reunion
TCATAAAGATATTGGAAGGTTATATTTTGTGTTTGGGGCTTGAGCTGGTGTAGTGGGAACATCTTTAAGAATGTTAATTCGAACAGAATTAGGTCATCCTGGGAGATTGATTGGAGATGATCAAATCTATAATGTGGTTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATGATTGGGGGGTTTGGGAATTGATTAGTGCCTCTGATACTAGGGTCTCCGGATATAGCTTTTCCTCGTATAAATAATATGAGATTTTGATTACTACCTCCTTCTTTAGTACTTTTACTTAGAAGTGGTTTAGTAGAGAGCGGTGTAGGAACAGGTTGAACAGTCTACCCTCCTTTAGCATCCGGGATCGCTCATAGAGGAGCTTCTGTAGATTTAGGAATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTTTAGGGGCTGTAAATTTTATTACAACAGTTATTAATATGCGTTCTCCAGGTATAAGACTAGATCGTGTGCCTCTATTTGTATGATCTGTTTTAATCACGGCTGTTTTACTATTACTATCCTTACCTGTTCTTGCTGGAGCAATCACTATATTATTAACAGATCGGAACTTAAATACTTCTTTTTTTGACCCTAGCGGAGGGGGGG
1er résultat en Blast ?
Select seq gb|KU530527.1| Idotea urotoma voucher NRM-CGI-000124 cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial query cover: 96% evalue:1e-167 ident:84%

Donc je confirme que les banques NCBI sont encore très très pauvres en isopodes... c'est même bizarre à ce point.

PS : pour info j'ai aussi repassé la séquence du Porcellio sp. blanc, mais je n'ai pas fait de nouveau message, juste édité.

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par entonantes44 » jeudi 8 décembre 2016, 23:01

De quoi te plains-tu au moins c'est un Isopode :mrgreen:

Super d'avoir mis les séquences!!!! Je regarde dès que j'ai un peu de temps! J'ai hâte de m'amuser un peu avec pour voir! :bienvu:
Brendan

noelouigre1
Animateur
Enregistré le : lundi 14 avril 2008, 11:23
Localisation : St Martin de Connée-53

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par noelouigre1 » samedi 10 décembre 2016, 11:49

Bonjour,
Le séquençage reste toujours un peu énigmatique pour moi :oops:
Le labo de Poitiers disposant de très nombreuses espèces, ne disposes-tu pas déjà du référentiel ?
Vous avez sous la main la plupart des familles et des genres (au moins pour les grosses espèces) donc j'imagine que ce ne doit pas être très compliqué ? (ou bien je me trompe complètement... ?)

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Pagana dimorpha] Cloporte de l'hémisphère sud

Message par DrPorcellion » samedi 10 décembre 2016, 17:31

Bonjour,
Sur le principe tu as bien compris, il suffirait que je fasse l'amplification du même fragment sur plein d'espèces pour me faire mon référentiel. J'espérais ne pas avoir à faire ça en utilisant les banques NCBI déjà disponibles. Mais le résultat est bizarre et j'ai du mal à le comprendre. C'est comme si on amplifiait pas le même fragment du gène... il faudrait creuser l'histoire mais ça demande un investissement en temps et potentiellement en argent s'il faut des manips supplémentaires.
Mais je sais par ailleurs qu'une phylogénie moléculaire des cloportes est en cours de préparation bien que je ne sois pas impliqué dans ce projet, patience donc ^^
Voilà pour les quelques éclaircissements.

Répondre Sujet précédentSujet suivant

Retourner vers « Isopodes »