[Jaera hopeana] Inconnu clandestin

Ici est le point de rendez-vous des Cloportes.

Animateurs : entonantes44, noelouigre1

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Jaera hopeana] Inconnu clandestin

Message par DrPorcellion » jeudi 15 octobre 2015, 13:08

Lors de l'observation des Sphaeroma (cf post précédent) à la loupe bino, j'ai eu la surprise d'observer ces isopodes, beaucoup plus petits :

Image
Anonyme : France : Ile de Ré : 17 : 09/10/2015
Altitude : NR - Taille : 1 mm
Réf. : 151268

J'ai envisagé l'hypothèse de pullies de Spheroma mais ça n'y ressemble pas trop, ou à des parasites mais ça n'a pas trop l'air d'être ça non plus... alors juste de la phorésie ?...

Pour l'identification, j'ai regardé sur estran22, ce qui s'y rapproche le plus selon moi c'est le genre Jaera. Qu'en pensez-vous ?

Balises :

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

Inconnu clandestin

Message par entonantes44 » vendredi 16 octobre 2015, 10:44

Complètement d'accord ce sont des Janiridae! :bienvu:

Ils sont vraiment petits, les photos ne sont pas faciles à faire à cette échelle. Mais on voit quand même assez bien.
Parmi les critères, les uropodes ne sont pas visibles. Difficile de les distinguer en vue ventrale. On voit très bien des épines sur les bords latéraux.
Par contre il n'y a qu'une seule espèce connue pour être ectocommensal des Sphaeroma :0013:
Et en plus elle se trouve sur S.serratum ce qui est un indice supplémentaire pour l'identification de l'hôte.
C'est une super observation!
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

Inconnu clandestin

Message par DrPorcellion » vendredi 16 octobre 2015, 12:36

Ah super ! Je suis content, grâce à ton indication, j'ai trouvé : il s'agit de Jaera hopeana. C'est bien ça ? :-)
Je confirme qu'il s'agirait donc de commensalisme/phorésie.
Merci beaucoup !

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

Inconnu clandestin

Message par entonantes44 » vendredi 16 octobre 2015, 13:06

Oui c'est bien ça. :)
Et par curiosité ils étaient combien pour un Sphaeroma?
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Jaera hopeana] Inconnu clandestin

Message par DrPorcellion » lundi 18 avril 2016, 12:00

Je me rends compte que je n'ai pas encore répondu ! Pour avoir redisséqué quelques Sphaeroma il y a peu : j'en trouvais fréquemment 2-3 par individus, parfois aucun, et peut-être jusqu'à 4 ou 5 maxi. Ils sont très vifs et se cachent souvent sous les pattes de leur hôte. Quand ils sont dérangés, ils font un petit tour à la surface et reviennent se cacher rapidement.
Modifié en dernier par DrPorcellion le mercredi 7 décembre 2016, 16:51, modifié 1 fois.

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Jaera hopeana] Inconnu clandestin

Message par entonantes44 » mardi 19 avril 2016, 20:24

Merci pour le suivi :bienvu:

5 ça commence à faire du monde sous les péréiopodes!
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Jaera hopeana] Inconnu clandestin

Message par DrPorcellion » mercredi 7 décembre 2016, 16:55

Et la séquence COI correspondante :
GGGTGACCAAAAAATCAGAATAAGTGCTGGTATAAAATAGGATCACCACCTCCTGCTGGGTTGAAAAATGTAGTATTTAGGTTTCGATCTGTTAATAGCATAGTAATTGCACCCGCAAGCACAGGGAGGGAAAGTAGAAGAAGAATTGTTGTAATTAAAATAGAGAAACAATATAGGGTGATTTGGTTTATAGTTTTATTATTAATTCTATTATTAATGATAGTAGAAATAAAATTAATAGCACCTAAAATTGATGAAATACCAGCTAGATGGAGTGAAAAAATAGCTAGATCTACAGCTGGTCCTCTATGAGTTTGTGTTGTTGCAAGTGGAGGGTAAACTGTTCAACCTGTACCAACTCCCCCTTCAATAGTGGAACTTAAGATTAATAGAGATAGAGATGGTGGTAATAATCAAAATCTTAGGTTATTCAGACGAGGATAATATATATCAGGGGAGGCTATAATTAATGGTAAAAGTCAATTACCAAAACCACCAATAAGGATTGGTATAACTATAAAAAAAATTATTAAAAAAGCATGTGATGTAACGATTACATTATATAGTTGCGAATCACATAAGAAATTATTTGGCATTGCTAATTCTGTTCGAATTAAAGTTCTTGAAGCTACACCCAATAAACCAGCTCACATACCTAGAATTAGGTAGAGGGTACCAATATCTTTATGAT
Encore une fois le Blast ne donne presque rien (juste des Ligia...). Je commence à soupçonner qu'il y ait plusieurs régions de la COI utilisées en barcoding car j'ai vérifié et il y a qd même de nbses séquences séquences de COI dans la banque NCBI. Si elles ne sortent pas du tout, c'est que cette "query" ne doit pas correspondre au même amplicon... je suppose... (et désolé pour le charabia ^^)

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Jaera hopeana] Inconnu clandestin

Message par entonantes44 » samedi 10 décembre 2016, 16:34

Il y a un truc qui doit m'échapper. Je le blast et j'obtiens 100% avec Melita palamata (Amphipoda) 8-O . Je me suis fais avoir au début car en le refaisant sous ClustalW je n'avais pas vu qu'il me proposait 100% d'homologie avec la séquence prise à l'envers!
(blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=4S73JYXU01R) Lien valable uniquement pendant 24h.

Tu as choisi tes amorces comment? Où? (si ce n'est pas indiscret, si tu préfères tu peux me répondre en MP).
En Isopode j'ai là un bout pour Sphaeroma serratum (https://www.ncbi.nlm.nih.gov/nuccore/KR424584.1).
Brendan

Avatar du membre
DrPorcellion
Membre
Enregistré le : vendredi 18 septembre 2015, 12:57
Localisation : Poitiers

[Jaera hopeana] Inconnu clandestin

Message par DrPorcellion » samedi 10 décembre 2016, 17:35

Ce sont des amorces universelles je crois, répondant au doux nom de HCO et LCO.
Et qqch m'échappe aussi. Je n'ai pas trop de doute sur mon séquençage, c'est du Sanger et c'est fiable. Par contre pour expliquer le blast...

Avatar du membre
entonantes44
Animateur
Enregistré le : dimanche 20 juillet 2014, 21:10
Localisation : Gironde / Charente Maritime

[Jaera hopeana] Inconnu clandestin

Message par entonantes44 » samedi 10 décembre 2016, 18:39

Du Sanger!! Ça se fait encore ça 8-O

Peux-tu me détailler un peu ton protocole stp, juste histoire que je comprenne bien?

J'imagine, tu traites à la chitinase, tu fais une lyse cellulaire douce, centrifugation différentielle tu récupères tes mitochondries, tu extraits ton ADN mitochondriale. Ensuite, tu envoies à séquencer avec tes amorces universelles? Ou tu fais ça toi même au labo?
Ou bien, cela se fait directement, lyse puis extraction d'ADN total et hop séquençage? Il y a peut être des kits pour la préparation?
Brendan

Répondre Sujet précédentSujet suivant

Retourner vers « Isopodes »

Qui est en ligne

Utilisateurs parcourant ce forum : Aucun utilisateur enregistré